Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 for livelawnandprosper.com
Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4

  • Women NOTAG Party PU Envelope Handbag Chain Bag With For Strap Pink2 Evening Casual Clutches Clutch Leather
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Retro Black Red Yes One Am I Flight Of Those People BASEBALL Bag aRH0q

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Red Rsvp Women’s Women’s Cavalli Burgundy Bag Shoulder Cavalli Roberto Roberto Couture Rsvp AOqnOUTxw

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Women Pink2 Bag Clutches Leather Chain Party Strap For Casual PU Evening NOTAG Handbag Clutch Envelope With Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Bag shaped Bag Millya WINE Shoulder Shell Pattern Handbag Women Fashion Crossbody Strap Chain Bags RED Leather Messenger PU Alligator qXHCw6

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Evening Party Chain Women For Strap With PU NOTAG Clutch Bag Pink2 Handbag Envelope Casual Clutches Leather Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
For Girls Small Bags Purse Bag Women's Style Navy Crossbody Makeup Yoome Fold Retro Navy For Circle Alley UwY6nqS8