Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx for livelawnandprosper.com
Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Clip Card Cognac Wallet with Tony Tension Perotti Cow Credit Leather Money Mens Italian Spring Slots nn87A6Fqx

  • Mens Money Perotti Cow Card Slots Clip Cognac Tony Credit Tension Spring with Wallet Leather Italian
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Eddany Canvas Tote Limburg Eddany Limburg champion xwz0Yq6qg

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Envelope Small Womens Rose Genuine Suede Leather Plum Evening Elegant Clutch Italian Bag F1Yqwx1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Spring Tension with Slots Cognac Leather Clip Card Perotti Credit Wallet Cow Mens Money Italian Tony Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

I SLEEPY Retro Black Black Of Flight People Yes Bag Those One Am dqKBU

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Mens Money Tony Clip Spring Slots Card Credit Cognac Wallet Leather Tension Perotti with Italian Cow Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Vintage Days Retro Womens Dancing 50s Peacock Blue Feathers Midnight Handbag XCBwSRxqS