Dog Labrador Signare Bag Women Body Bag Shoulder Top Handle Handbag Tapestry LAB CONV Cross wgxCSwPq for livelawnandprosper.com
Dog Labrador Signare Bag Women Body Bag Shoulder Top Handle Handbag Tapestry LAB CONV Cross wgxCSwPq Dog Labrador Signare Bag Women Body Bag Shoulder Top Handle Handbag Tapestry LAB CONV Cross wgxCSwPq Dog Labrador Signare Bag Women Body Bag Shoulder Top Handle Handbag Tapestry LAB CONV Cross wgxCSwPq Dog Labrador Signare Bag Women Body Bag Shoulder Top Handle Handbag Tapestry LAB CONV Cross wgxCSwPq Dog Labrador Signare Bag Women Body Bag Shoulder Top Handle Handbag Tapestry LAB CONV Cross wgxCSwPq Dog Labrador Signare Bag Women Body Bag Shoulder Top Handle Handbag Tapestry LAB CONV Cross wgxCSwPq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Dog Labrador Signare Bag Women Body Bag Shoulder Top Handle Handbag Tapestry LAB CONV Cross wgxCSwPq

  • Women Handbag Bag Signare Cross Top Labrador Dog LAB Bag Shoulder Body CONV Tapestry Handle
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Tote Body Bag Shoulder Black Designer Split Women Leather Ladies Bag Handbags Cross Hobo Handbags Bags Bag for TzTExqIvw

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Jo Met Cross W9850 Body Bag Brown Anna Women’s Multicolour Double Nero Pale Liu dx4wfqIvAd

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Dog Women Signare Top LAB Handle Body Labrador Bag Shoulder Cross Bag Handbag CONV Tapestry Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Black HandBags Elegant Girly Girly HandBags Bag Suede Clutch qwxU8p7T

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Cross Dog Labrador LAB Shoulder Handle CONV Signare Top Body Women Handbag Tapestry Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Saddle Harold's cm Schwarz Bag Shoulder Saddle Leather Harold's 23 vpHHqSwZO