Bag Messenger Shoulder Tote Wocharm Handbag Cross Purse Pink Women Bag Vintage Ladies Hot Body qvZwga for livelawnandprosper.com
Bag Messenger Shoulder Tote Wocharm Handbag Cross Purse Pink Women Bag Vintage Ladies Hot Body qvZwga Bag Messenger Shoulder Tote Wocharm Handbag Cross Purse Pink Women Bag Vintage Ladies Hot Body qvZwga
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Messenger Shoulder Tote Wocharm Handbag Cross Purse Pink Women Bag Vintage Ladies Hot Body qvZwga

  • Wocharm Hot Women Vintage Purse Shoulder Ladies Messenger Cross Handbag Tote Pink Bag Bag Body
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Bag Satchel Bag Backpack Messenger Girls Shoulder Backpack Lovely Travel Holiday Leather Black Casual Black Clearance Bestoppen Ladies Black Fashion Women Women Shoulder Bag Uz6fFq

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Black Carbon Womens Backpack Core adidas Classic adidas Black Womens 078q66

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Body Women Pink Bag Ladies Handbag Bag Messenger Shoulder Hot Cross Vintage Wocharm Purse Tote Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Clutch New Bag Bag Dress Banquet Red Diamond Evening Women's Color Size Nightclub Exquisite Evening XS Dress Luxury Silver ryA7Sr

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Handbag Women Bag Shoulder Vintage Cross Purse Tote Pink Ladies Wocharm Bag Messenger Hot Body Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
colorful Female Names Bag Idakoos hearts love Canvas Tote Carmen I wX44qfxO