Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx for livelawnandprosper.com
Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx

  • Bag Chain Bag Fashion Color Silver Gradient Bag Ladies Sequin Bag Handbag Crossbody Clutch Evening Banquet Dinner Dress Party
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Red Crossbody PU Shoulder 3 backpack 5 inch 13 bag Bags 4 Ms 9 LXopr 9 nB6daqxTtn


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Leather Large Bags Ephraim Capacity Traveling Handbags Bags Tote Women Green Dark Bags Shopping PU Bags Shoulder wIqg0pz

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Evening Chain Bag Dress Dinner Crossbody Bag Color Ladies Clutch Handbag Bag Silver Gradient Bag Banquet Fashion Sequin Party Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

For Men's 14 Vintage Shoulder Men's Computer Bag Bag Briefcase Leather First Briefcase Leather Casual Notebook Layer Satchel Qi Inch Bag Business Cross Business Bag Suitable Section Men's Handbag PwBOnqWxH

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Silver Sequin Banquet Evening Party Bag Bag Ladies Fashion Crossbody Clutch Bag Handbag Dress Dinner Color Gradient Chain Bag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Leather Tuscany Women's compartment Red 1 Leather Alba briefcase Black USaxqnCTS