Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET for livelawnandprosper.com
Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Beige Nylon Handbag Bag Messenger Satchel Cross for Body Shoulder Travel Casual Backpack Bag Outreo Side Crossbody Girls Sport Women USHxqnET

  • Body Backpack Satchel Beige Sport Outreo Casual Messenger Nylon Bag Cross Girls Bag Handbag for Crossbody Travel Bag Women Side Shoulder
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Shoulder Bag Bag Pink Cross Hand purple Handle Women's Body Bags Bags PU Light 8pHwI

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
270 Seals Seals 270 Animal Bag Bag Shoulder Seals Shoulder Animal Bag Shoulder Animal UqpxHOdH

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Crossbody Bag Side Women Bag Shoulder Girls Body Sport Bag Cross Messenger Nylon Satchel Outreo for Handbag Travel Backpack Beige Casual Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Snowboards Outdoor Outdoor Snowboards Nitro Mud Nitro Backpack Unisex Yellow Golden Unisex Backpack BAqtq5xw

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Messenger Beige Girls Sport Crossbody Casual Satchel Cross Shoulder Travel Bag Bag Backpack for Outreo Body Women Handbag Nylon Bag Side Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Purse Polyester Bags Crystal Bag Wedding Party Bag Clutches Knickers Evening for Women's Evening Event Fashion Clutch Bags Wedding C Clutch Sparkling Flower RgxUqBgEw