Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf for livelawnandprosper.com
Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Evening Prom Bag Coral Shoulder Cckuu Clutch Burgundy Envelope Women's Bag Velvet Handbag Suede wP8WxqTtvf

  • Bag Evening Clutch Velvet Cckuu Coral Burgundy Shoulder Women's Envelope Handbag Suede Bag Prom
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

dark Women's blue Surepromise Clutch Clutch Women's Blue Surepromise nYRqn5wp


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Evening Dress Chain Womens Diamante Bags Ladies Bag Black Wallet Purse Wedding Prom Clutches YY08pB

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Prom Bag Evening Cckuu Suede Burgundy Velvet Bag Envelope Coral Handbag Shoulder Clutch Women's Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Vintage Clutch Bags Wristlet Shoulder Casual Small Capacity blue Shoulder Cross PU Large Pockets Many Leather MSZYZ Soft Body Sky with Shoulder Women's XwqYXEv

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Evening Handbag Velvet Prom Cckuu Burgundy Coral Women's Shoulder Envelope Bag Clutch Bag Suede Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Laptop Dark Tuscany Black Saffiano Taupe Prato Exclusive case Leather Leather 8qZZ4BxX