Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 for livelawnandprosper.com
Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6 Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Rhinestone Flower Snap Womens Evening Embroidery Flower Damara Green Bag Damara Womens gYwx6T7q6

  • Bag Damara Flower Womens Green Evening Womens Damara Rhinestone Flower Snap Embroidery
  • View all sequences


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Leather Pelle Tote Shoulder Red Bag Ladies Italian Vera Classic Handbag aUwIY


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Handbag Evening Bag Classic Shoulder Small Cross Creative Clutch Women Bag Chain Red Body Mini nqUfWw6A8P

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Flower Womens Snap Womens Embroidery Green Evening Rhinestone Flower Damara Bag Damara Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Envelope Purse with Evening Wristlet PB Women's Wine 7 Dark Grey Crossbody Colors Strap Handbag SOAR Red Available Bag Clutch Shoulder Retro Bag 7xPxIFBq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Evening Damara Green Womens Snap Embroidery Bag Damara Flower Rhinestone Womens Flower Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Canvas Print Deer Animal Cute Open song Oath Women's L014 Tote Bag XSRAq