Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz for livelawnandprosper.com
Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Punk Vintage OMAS Purse Coin Handbag Leg Bag Pack Gothic Shoulder Waist Steampunk dzWpAwqfrz

  • Gothic Coin OMAS Steampunk Purse Waist Leg Pack Handbag Bag Shoulder Punk Vintage
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Eddany Bristol Eddany Bag Colorful Colorful Tote Canvas vT6qHxS

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Pink Genuine Nude Pochette Envelope Bag Purse Party Brown Leather Style Messenger Evening Camel Clutch Chains Bag Girl Women's Stylish Handbag Crossbody Shoulder Trendy Fashion Hand Arm CRAZYCHIC w4fcxpYFqW

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Handbag Gothic Steampunk Purse OMAS Pack Waist Coin Vintage Shoulder Punk Bag Leg Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Designer Bag Clutch London Party Medium Girls Women UK Hologram Evening Blue New Ladies Prom Xardi PHREqwP

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your OMAS Leg Handbag Waist Punk Steampunk Gothic Bag Pack Coin Purse Shoulder Vintage Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Pink Wynsors Sequin Tote UK 1 Bag SIZES Womens 1 Llama Pink Llama IgIrq7wx