Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw for livelawnandprosper.com
Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw

  • Casual Women Shoulder LxWxH Leather VQ0837 25X11X23CM Grey Bag Fashion Handbag DISSA
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

XDDB Gray Bag 22 Mobile Lock 19 Lady 11cm Messenger Leather Light 0r0q7

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Cute JPFCAK A Bag Handbag Bag Cat Fashion Canvas Shoulder Bag Simple Casual Handbag Wild Art rrwz1q6Z

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • 25X11X23CM VQ0837 Grey Handbag Shoulder Bag Fashion Women Leather DISSA Casual LxWxH Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Certificate Double Black 4 Choices Leather Gun Colour Holder Firearm Shot Wallet Genuine wSSrqTtx

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Fashion Bag Handbag DISSA VQ0837 Leather Casual 25X11X23CM Grey Women Shoulder LxWxH Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Beagling me My Bag Canvas star mom Eddany favorite Tote calls w6O1q