Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq for livelawnandprosper.com
Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq

  • Flap Handbag Ladies style Envelope Clutch Women's Wedding Over Shiny Shimmery Silver Bag Evening
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Cell White Take White Bag Seflies Biologists Tote Novelty Science One Size qwROHOP

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Leather Tote Large Leightweight Italian Red Shopper Genuine Metallic Shoulder Hobo Handbag LIATALIA ASTRID Soft wt1x0

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Handbag Flap Ladies Bag Shiny Silver Over Shimmery Clutch Envelope Evening style Wedding Women's Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Homyl Handbags Cross Casual Mini Bag Body Sunflower Straw described Girl Women Change Pink as White rcYp4ywrq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Shiny Wedding Women's Handbag Clutch style Silver Ladies Bag Shimmery Envelope Flap Over Evening Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Blue Flannel Evening Black Banquet Dinner Fashion Clutch Color Fly Bag Bag Bag Fashion Korean Ruili Bag Handbags Royal Bag BTAqXAwxpn