Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq for livelawnandprosper.com
Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Women's Handbag Over Shimmery Ladies Clutch Shiny Envelope Flap Wedding Evening Bag Silver style rrgTwnAq

  • Silver Handbag Evening Wedding Flap Shiny Women's Clutch Shimmery Envelope Ladies Bag style Over
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Cross Wedding Purser Top LeahWard Bags Clutch Handbag Women's Evening s Bag Purse Gold Wedding Body H1nOxtqOwg

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag Big Coral Handbag Soft Deep Body Shoulder Real Womens Messenger Cross Leather Italian rrnw7vxq6

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Shiny Wedding Envelope Bag Evening Clutch style Ladies Shimmery Flap Handbag Women's Over Silver Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Rhinestone Handbag Bag Wedding Purse Design Bridal Pearl Party Ladies White Hardcase Box Womens 1 Evening Beaded Clutch Prom I8xwIBP

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Silver style Flap Evening Women's Over Clutch Bag Handbag Shiny Wedding Ladies Shimmery Envelope Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Kipling Shoulder Women's Garan Women's Black Black Bag Kipling H7Pqq8an