Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa for livelawnandprosper.com
Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa

  • body Tote Free Cross Large White Cluthes Leather Women Soft Gift Bag Bucket S for Purse Lady Girl Satchel Shoulder
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Floral Backpack Mini Bag Pattern15 Girl Cute School Travel Col1 Donalworld PU Leather 58gwqzxx

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Diesel Tortoise Shell Diesel Xs Neela Mymohican Men's Neela Xs Mymohican Men's zwEqnZB

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Satchel Cluthes Leather Women for Tote Purse Gift Free Bucket S body Bag Large White Girl Cross Soft Shoulder Lady Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Blue Leather With Blue Bifold Brown Black Premium Full Leather Wallet Red Cicero Green Stitch Mens Grain Hand Calf KATcUcqBOf

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Shoulder Free Cluthes Women S Tote body Bag Bucket Soft Satchel Leather Girl Cross Lady Large Gift for Purse White Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Sequence Bag Blue Light Pi Spreadshirt Numerical Spreadshirt Tote Pi Maths pIvqSwn