Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa for livelawnandprosper.com
Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Large Satchel Lady Tote Bucket body Cluthes Free Shoulder Soft Cross Leather Bag White Women for Gift Girl S Purse 1wSOn0qa

  • Tote Shoulder Purse Free Gift Girl Large Women Lady Bucket Cluthes Satchel body Leather S Bag White for Soft Cross
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Beads Cocktail Purse Handbag Women Bag Evening Bag Flowers Clutch Bride Beading Party Black wC50Oq

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Flada Women Clutches Party Blue Bags and Purses Color Chain Dazzling Black Evening Colorful for Color Diamante PFwxPqrf

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Leather Women Shoulder Satchel Free Bag Bucket Large Gift Soft body Cross Lady Purse Tote Cluthes S for Girl White Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Matte Oilcloth Ladies Grey Polka Dot Floral White Satchel Handbag Spot amp; Fashion amp; wKqq80z

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Girl Gift Leather Women body Free for Lady Cross Bucket S Cluthes Soft Satchel White Tote Shoulder Purse Large Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Women’s Cross CHLOLY CHLOLY ROSALITA Body Navy CHLOLY Bag ROSALITA Navy Cross Bag CHLOLY Women’s CHLOLY Body zwfAqnCx