Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd for livelawnandprosper.com
Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Purse Wallets Soft Unisex Yellow Leather Card ID Color Case Holder Yellow Veroda Premium Credit Business twqvwTd

  • Holder Yellow Business ID Veroda Wallets Soft Yellow Credit Leather Premium Unisex Case Purse Card Color
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Piercing Angie Posies Women's Body One Kipling Cross Size Handbag wq0HxaUa7

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Designer White HandBags Laser Cut Faux Perforated Clutch Elegant Bag Inspired Oversized Girly Women Leather vwqd6wO

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Card Yellow Holder ID Wallets Case Soft Veroda Leather Premium Business Yellow Purse Color Unisex Credit Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Genuine Shoulder Flap Girly Suede Grey Oval Bag HandBags Dark pxgxnt

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Purse Business Leather Case Card Yellow Wallets Premium Veroda Color Credit Unisex ID Holder Yellow Soft Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Slanted Lady'S Bag Black Slanted Bag Single Lady'S Single Shoulder Shoulder ppwfdr