Nude Ladies Bag Patent Evening Leather Envelope Clutch Plain Party C7UqC8w for livelawnandprosper.com
Nude Ladies Bag Patent Evening Leather Envelope Clutch Plain Party C7UqC8w
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Nude Ladies Bag Patent Evening Leather Envelope Clutch Plain Party C7UqC8w

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Purse Evening Womens Light Clutch Large Textured Shiny Gold Quilted Damara Bag wTx4HRAAq

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Handbags Leather 29cm Large L Grey Satchel Hobo Handbags H Crossbody Shoulder 39cm Women W Dark Bags JOYSON PU 16cm 0zHqSS

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Patent Party Leather Clutch Bag Evening Nude Envelope Plain Ladies Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

E Sequined Evening Wedding Beaded Cocktail Fully Clutch Antique Purse Mesh Formal Style Women's 5O7x0wq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Party Bag Evening Clutch Plain Nude Patent Leather Ladies Envelope Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Embroidery VintageTote Shoulder Small Handbag D DOLITY Red Purse Florals Women Bag qWwSWt67vx