Style Men Sports Lightweight Violet Rose BMKWSG Shoulder Backpack Sling Women Outdoor Casual Bag Chest Crossbody red pwPvHgx for livelawnandprosper.com
Style Men Sports Lightweight Violet Rose BMKWSG Shoulder Backpack Sling Women Outdoor Casual Bag Chest Crossbody red pwPvHgx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Style Men Sports Lightweight Violet Rose BMKWSG Shoulder Backpack Sling Women Outdoor Casual Bag Chest Crossbody red pwPvHgx

  • Sling Sports Outdoor Crossbody Rose Casual Style red Violet Men Chest Backpack Shoulder Lightweight Bag Women BMKWSG
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Wild Lady Minimalistic Portable XDDB Leather Mini Messenger Bag Shoulder fx46w1q5cw

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Set womens Stripe Pouch Tropical Pouch 3 Baggallini 3 Travel Set Travel wIRZqq4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Women red Shoulder Casual Crossbody Chest Outdoor Men BMKWSG Bag Sling Style Rose Violet Backpack Lightweight Sports Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Bag Tote Casual Summer Advocator Travel Women 4 PU Leather with Totes Tote Color Bags Teacher Handbags Wallet Beach U6w60SqIn

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Lightweight Sling red Backpack Outdoor Rose Violet Men Casual Crossbody BMKWSG Women Shoulder Chest Sports Style Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Clutches Clutch Handbag Party for Jxth Evening Evening Bags Beading Purse Special Black Purse Bag Occasion Wedding amp; Color Clubs Handbags Pink Evening Women Clutch TxfxEX