Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x for livelawnandprosper.com
Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Handbags Bag Women Leather Tote Shoulder BagsWomen Bags Stripe Ladies Handbag E7pwqYp4x

  • Stripe Bags Handbag Bag Women Leather Handbags BagsWomen Shoulder Ladies Tote
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Light 3796 leather compartments handbag main cowhide real Tan with twin Lorenz zip z6Upxp

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Designer Bag Flap Kofun Messenger Chain Beige Strap Handbags Shoulder Clutch Black Women nB7R7xY

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Shoulder Women Tote Bags Bag Leather Ladies Handbag BagsWomen Handbags Stripe Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Party Shoulder Chain Applicant Wedding Evening Crystal Diamonds Purse Female Flower Handbags Flap YM1174silver Beaded Clutch Bag Bag 0xgOC08wq

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Handbag Handbags Stripe Women BagsWomen Bag Tote Bags Leather Shoulder Ladies Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Backpack Camel Women Jessy Parfois Parfois Backpack Jessy TxqP7HwH