Bag Small 4 New Mobile Four Shoulder Women's Bag Purse Bucket Bag Tassel Phone Messenger Sets Mother FOOqUIZ for livelawnandprosper.com
Bag Small 4 New Mobile Four Shoulder Women's Bag Purse Bucket Bag Tassel Phone Messenger Sets Mother FOOqUIZ Bag Small 4 New Mobile Four Shoulder Women's Bag Purse Bucket Bag Tassel Phone Messenger Sets Mother FOOqUIZ Bag Small 4 New Mobile Four Shoulder Women's Bag Purse Bucket Bag Tassel Phone Messenger Sets Mother FOOqUIZ Bag Small 4 New Mobile Four Shoulder Women's Bag Purse Bucket Bag Tassel Phone Messenger Sets Mother FOOqUIZ Bag Small 4 New Mobile Four Shoulder Women's Bag Purse Bucket Bag Tassel Phone Messenger Sets Mother FOOqUIZ Bag Small 4 New Mobile Four Shoulder Women's Bag Purse Bucket Bag Tassel Phone Messenger Sets Mother FOOqUIZ
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Small 4 New Mobile Four Shoulder Women's Bag Purse Bucket Bag Tassel Phone Messenger Sets Mother FOOqUIZ

  • Bucket Bag Bag Women's Four Small Tassel Purse Messenger Shoulder 4 Sets Bag New Mobile Mother Phone
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

MyDaily Rottweiler Bag Shoulder Shoulder Dog Large Tote Tote Handbag Women Handbag Rottweiler Dog Women Large Bag MyDaily OAwxO8

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
in shoulder Italy Dark made bag Cm Blue leather Woman's D6170 genuine CTM in 41x55x12 qptfwf

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Phone Mobile Bag Small Shoulder Sets New Purse Bag Messenger Four Women's Bucket 4 Mother Bag Tassel Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Over Office Shoulder Large A4 Designer Leather Khaki Black Handbag Tote Serpentine Bag PU Bag Briefcase Women Female For Ladies HYZx0F

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Messenger Mother Small Mobile 4 Shoulder Bag Tassel Bag Purse Bucket Phone Bag Sets Women's New Four Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Shoulder cm Leisure blue Backpack Ms amp;F 30 Backpack Y package 16 Bags 34 nSpCt