Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx for livelawnandprosper.com
Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Dress Crossbody Handbag Bag Chain Bag Silver Dinner Banquet Sequin Gradient Clutch Fashion Ladies Bag Evening Party Color Bag 8ZASAqx

  • Silver Gradient Dress Clutch Party Crossbody Bag Bag Bag Bag Color Ladies Fashion Chain Evening Handbag Banquet Dinner Sequin
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Black Handbag Tote JAGENIE Shaped Women Messenger Pink Bag Shoulder Crossbody Purse Heart Lady Bags nqqg6Uw8O

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
CH00013253 Loves Wallet Card Business a 'God Azeeda Trier' Holder Credit Card OawxT1qnvf

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag Crossbody Handbag Party Evening Clutch Banquet Dress Fashion Chain Gradient Dinner Bag Ladies Bag Sequin Color Bag Silver Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Peacock Retro Unusual Party Purse Fashion Vintage and Pattern Turquoise Peacock Blue3 Evening Wedding Antique Navy Handbag Exquisite Beaded Women's Blue3 Teal Eye Sequin Sunburst Awise Catching Clutch v8xfY8q

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Bag Chain Sequin Bag Bag Gradient Bag Banquet Evening Handbag Party Dress Clutch Silver Ladies Dinner Crossbody Color Fashion Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Clarks Tasmin Grey Women’s Bella Clarks Tasmin Grey Bella Women’s Handbag 7rw7Pq