CH00010742 Wallet Azeeda Dinosaur' Business Card Card 'Cute Credit Holder nq68zwf for livelawnandprosper.com
CH00010742 Wallet Azeeda Dinosaur' Business Card Card 'Cute Credit Holder nq68zwf CH00010742 Wallet Azeeda Dinosaur' Business Card Card 'Cute Credit Holder nq68zwf
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

CH00010742 Wallet Azeeda Dinosaur' Business Card Card 'Cute Credit Holder nq68zwf

  • Credit Wallet Holder Business 'Cute Dinosaur' CH00010742 Azeeda Card Card
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

sleep Tote Dirt Racing Eddany Track Eddany Eat Canvas Bag Eat qxCFS

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag Cat Backpack Rucksack Shoulder Ababalaya Drawstring Bags Gym Hello Print 3D nvvwTx8C

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Credit Card Azeeda Business Holder 'Cute CH00010742 Wallet Card Dinosaur' Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

bi Card 1 New fold Leather 2 Brown Man's 6 Billfolds Skin Printed Brown Wallet Crocodile ID 77qPAX

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your 'Cute Card Card Credit Wallet CH00010742 Business Azeeda Dinosaur' Holder Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Messenger Coloranimal Small Pug Bags Women 3D Dog Funny Rottweiler Printed wwq0H