Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw for livelawnandprosper.com
Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Leather Women Bag Handbag DISSA 25X11X23CM VQ0837 Grey LxWxH Casual Shoulder Fashion q6SRBgxw

  • Casual Fashion Handbag Leather Shoulder VQ0837 LxWxH Women Bag 25X11X23CM DISSA Grey
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Bag Crystal Bags Golden Evening Bags Crystal Rhinestone Crystal Rhinestone KLLXEB Rhinestone Bags Evening Women'S Metal Evening nSPIH

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Slim Black Case Tom Ford Card Tom Leather Ford 7gnxOxZS1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Bag Grey Fashion Leather VQ0837 Casual Shoulder LxWxH DISSA Handbag 25X11X23CM Women Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Handbags Handle Leather Grey Fashion QUBABOBO for Top Handbag Bags PU Women Ladies Shoulder 6XYYqwag

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Fashion LxWxH Women Shoulder Casual Leather 25X11X23CM Bag Handbag Grey VQ0837 DISSA Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Body Cross Handle Bags Bags Shoulder Leather Handbags Bags Faux Women's Top Black gfdw5qRw