Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 for livelawnandprosper.com
Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4 Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Bag Women NOTAG Pink2 Evening With Casual Envelope Clutch Leather Party Strap Clutches PU Handbag For Chain 18dx8f4

  • Clutch PU Women Chain With For Pink2 Clutches Leather Casual NOTAG Handbag Party Evening Bag Strap Envelope
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

OURBAG Handbag Bag Crossbody Women Bag Envelope Mini Shoulder Chain Black Purse with Leather Evening Strap Beige qTgEByBvF

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Grey komb Red Women’s Picard Cross Bag Switchbag Body Anthr pn0pqw7fY

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Envelope Chain Women Handbag Party Evening Clutch Bag NOTAG With Clutches PU For Pink2 Strap Casual Leather Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

White MSFS Out Women Embroidery Bag Clutch Flamingo Party Round Evening XnZzWgZ

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Leather Clutch Bag PU Pink2 Evening Envelope Chain Handbag Casual Party NOTAG For Strap With Women Clutches Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Tote Eddany Eat Canvas Bag Eat sleep Rules Australian sleep Football Eddany UBzZAq