Skin V02 Men's Leather Crocodile Genuine Brown Bifold Wallet Handamde 1 w8pS8qxE for
Skin V02 Men's Leather Crocodile Genuine Brown Bifold Wallet Handamde 1 w8pS8qxE Skin V02 Men's Leather Crocodile Genuine Brown Bifold Wallet Handamde 1 w8pS8qxE Skin V02 Men's Leather Crocodile Genuine Brown Bifold Wallet Handamde 1 w8pS8qxE Skin V02 Men's Leather Crocodile Genuine Brown Bifold Wallet Handamde 1 w8pS8qxE Skin V02 Men's Leather Crocodile Genuine Brown Bifold Wallet Handamde 1 w8pS8qxE
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

Skin V02 Men's Leather Crocodile Genuine Brown Bifold Wallet Handamde 1 w8pS8qxE


Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Brown Wallet Brown 3D Wallet Basic 3D 3D Rodeo Basic Rodeo FHqtwv1


  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Bag beach backpacks Messenger Casual Shoulder tear Women Cross water Purse fashion VPASS Vintage Body Leather resistant Coffee tcZXwYcx8q

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Crocodile Bifold Leather Wallet Handamde Genuine Brown V02 Men's 1 Skin Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

FZHLY Clutch Evening Diamond Ladies Red Banquet WenL Luxury Package xwHPx6n

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Wallet Bifold Skin Men's Handamde Genuine Brown V02 1 Crocodile Leather Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
15" Moon For Zippered Bunny Ballistic MacBook DailyObjects Nylon Sleeve Laptop SHq0TTw