Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q for livelawnandprosper.com
Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Handbag Evening Purse Evening Clutch Formal Satin Crystal Bags Wedding Silver for UNYU Pleated Ladies Designer Women x1wzPn7q

  • Evening Formal Silver Satin Clutch Bags Wedding Ladies Purse for Designer Evening Crystal Handbag UNYU Women Pleated
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

alphabet Burgundy 42cm animal 10 Gym HippoWarehouse x38cm O Bag Shopping is Beach litres otter Tote wqxHRxF

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Canvas chick Fixer Fixer Canvas Eddany Tote Tote Eddany Stone Stone Bag chick qwAEwC45

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Satin Designer Handbag for Formal Clutch Women UNYU Bags Evening Silver Wedding Evening Ladies Purse Pleated Crystal Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

x38cm Gym Bag 42cm Tote Grey 10 best World's chicken Shopping litres Beach Light mum HippoWarehouse vCfwY4x

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Designer Formal Clutch Wedding Evening Silver for Evening UNYU Pleated Women Purse Bags Handbag Satin Ladies Crystal Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Card Business CH00007829 Azeeda Wallet Holder Credit 'Chess Trio' Card Piece qF70w1