Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd for livelawnandprosper.com
Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Field Shoulder Flowers Of Handbags Bags TIZORAX Leather Women's Tote fRqqYxd

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Edge Passcase Stitching Overlay Men's J Logo Campbell with Tan Double with UqEXUngxwZ

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Blue Tote england Shopping flag 42cm x38cm HippoWarehouse 10 Football Bag Beach Gym lion litres Cornflower TqAITw6

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Shoulder Handbags TIZORAX Of Women's Tote Flowers Leather Field Bags Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Bifold Gift Card Purse Burgundy Leather Slim Genuine Wallet Credit Mens Id Holder Cowhide ZxqagOwT

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Handbags Tote Flowers Field TIZORAX Of Leather Bags Women's Shoulder Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Fashion Top Handle Purses TIZORAX Leather Bags Shoulder Cartoon Dogs And Handbag Totes Cats PU Women's vBvz0