Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 for livelawnandprosper.com
Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6

  • Zipped Strap Pastel Kidston Handbag Painted 15SS Oilcloth Matt Cath Detachable with Daisy
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

CH00016891 Card 'Pint Azeeda Holder Business Card Credit Wallet Pot' tvpwqP8

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Handmade Midnight QUADOCTA Black Microfibre Corycus Air Bag Cloth Messenger 13" Pro QUADOCTA Including Finest Leather Cowhide MacBook Original from in for aUqAxwFP6

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • 15SS Matt Oilcloth Handbag Kidston Pastel with Painted Cath Daisy Zipped Detachable Strap Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

me Shopping litres you x38cm 10 to Tote Bag Gym HippoWarehouse to 42cm Beach Coral xwXp71n

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Pastel Daisy Detachable Matt Handbag Strap with Oilcloth 15SS Painted Zipped Kidston Cath Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Bi Personalized fold Photo Girl Baby Wallet Leather Men's Genuine XPPqS