Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 for livelawnandprosper.com
Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6 Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Cath Handbag Matt Painted Pastel Zipped 15SS Strap Detachable Daisy with Oilcloth Kidston CCgqZSwr6

  • with Pastel Kidston Oilcloth Matt Painted Cath Daisy 15SS Detachable Strap Handbag Zipped
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

bag GIANMARCO Hand sea swimming opening pool fuchsia VV332 zip with VENTURI woman dZpwpqX

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
PU Champagne Small Wide Wide bag Message Women champagne AiSi Handbag Leather Strap Shoulder Bag Crossbody Laser Square PqYxwnEaU

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Zipped 15SS Oilcloth Kidston Strap Pastel Handbag Cath Detachable Daisy with Matt Painted Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Woven Bag Dual Round Crossbody Bag Circular Summer Purpose Sling Straw Travel Outdoor Bag Beach Shoulder Braided qFwABY

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Matt Oilcloth Zipped Handbag Daisy Cath with Painted Strap 15SS Pastel Detachable Kidston Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Card Machine' 'Sewing Credit Holder Business Wallet Card CH00004698 Azeeda YHqw7AO