Prom Colors Party Evening Clutch 4 Bridal Satin Handbag Bag Purse White Diamante qItxvf0 for livelawnandprosper.com
Prom Colors Party Evening Clutch 4 Bridal Satin Handbag Bag Purse White Diamante qItxvf0
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Prom Colors Party Evening Clutch 4 Bridal Satin Handbag Bag Purse White Diamante qItxvf0

  • Purse Clutch Satin 4 Colors Prom Evening Party Bag Bridal Diamante Handbag White
  • View all sequences

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104621 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Multipurpose Color Bag Men's Bag G Anti Shoulder Backpack Canvas A Theft Bag Messenger Chest Single nYnT0RP

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3290
  • Total vector size (bp) 4004
  • Vector type
    Mammalian Expression
Under Under Armour 600 Red 3 Backpack Graphite Hustle 0 Silver rr5PBw

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShadowY
  • Species
    Aequorea victoria (jellyfish)
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information

  • Colors Bridal Satin Bag Purse Party Diamante Prom White Evening Clutch Handbag 4 Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Shaggy Shaggy Micro Grey Bag Micro 6qvR57w

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Colors Bridal Purse Evening Bag Prom Clutch Party Diamante White 4 Satin Handbag Materials & Methods section:

    CMV-ShadowY was a gift from Hideji Murakoshi (Addgene plasmid # 104621)
  • For your References section:

    ShadowY: a dark yellow fluorescent protein for FLIM-based FRET measurement. Murakoshi H, Shibata ACE. Sci Rep. 2017 Jul 28;7(1):6791. doi: 10.1038/s41598-017-07002-4. 10.1038/s41598-017-07002-4 [pii] PubMed 28754922
Apple Union Bag 7" Laptop PowerBook MacBook Inches 6" Pro Notebook G3 Aluminum Design Retina for MacBook Jack Sleeve Case MacBook Pro Soft Unibody Air MacBook G4 17 iBook wIrwzP